Di truyền học và cơ thể sống

Từ Thư viện Khoa học VLOS
Bước tới: chuyển hướng, tìm kiếm

1. Định nghĩa di truyền học. Bạn có nghĩ rằng những nhà lai ngựa chiến Ai Cập cổ là nhà di truyền học ? Những phương pháp mà họ sử dụng khác với các nhà di truyền học hiện đại như thế nào ?

2. DNA điều khiển những đặc tính phổ quát của một loài như thế nào ?

3. Hai điểm đặc biệt nào của DNA khiến nó thích hợp với vai trò là một phân tử mang tính di truyền ? Bạn có nghĩ là có một số dạng biến đổi của các phân tử di truyền được tìm thấy trong các dạng sống ngoài trái đất ?

4. Có bao nhiêu phân tử DNA có thể hình thành từ một mảnh DNA gồm 10 cặp base về chiều dài ?

5. Nếu thymine (T) đóng góp 15 % số base của một mẫu DNA nào đó, bao nhiêu % base là cytosine ?

6. Nếu G + C chứa trong một mẫu DNA là 48%, tính tỉ lệ bốn loại nucleotide khác nhau.

7. Vẽ một hình đơn giản về DNA trong đó làm rõ:

a. Cái gì là đầu 5' và 3'

b. Cái gì là khung đường-phosphate

8. Mỗi tế bào của cơ thể người chứa 46 nhiễm sắc thể

a. Có bao nhiêu phân tử DNA hiện diện trong tình huống này ?

b. Có bao nhiêu loại phân tử DNA khác nhau hiện diện trong tế bào người ?

9. Một đoạn DNA nào đó có trình tự như sau trên một mạch:

5' - ATTGGTGCATTACTTCAGGCTCT - 3'

Trình tự trên mạch còn lại là gì ? (Đánh dấu đầu 5' và 3')

10. Trong một mạch đơn của DNA, có bao giờ xảy ra trường hợp số lượng adenine (A) nhiều hơn nhiều số lượng thymine (T) ?

11. Trong một mạch xoắn kép DNA bình thường, có thật là

a. A cộng với C sẽ luôn bằng G cộng với T ?

b. A cộng với G sẽ luôn bằng C cộng với T ?

12. Đề xuất rằng phân tử DNA sau sao chép để tạo ra hai phân tử DNA chị em. Vẽ những phân tữ DNA chị em này, bằng cách sử dụng màu đen cho các nucleotide đa phân có sẵn và màu đỏ cho các nucleotide đa phân mới:

3'- TTGGCACGTCGTAAT - 5'

5'- AACCGTGCAGCATTA - 3'

13. Trong phân tử DNA ở vấn đề 12, thừa nhận mạch bên dưới là mạch khuôn mẫu, hãy vẽ phân tử RNA được phiên mã (đánh dấu đầu 5' và 3')

15. Những nguyến tố thường gặp nhất tron cơ thể sống là C, H, N, O, P, S. Nguyên tố nào không tìm thấy trong DNA ?

16. Gene là gì ? Có một số vấn đề gì với định nghĩa của bạn ?

17. gene mã hóa protein albumin ở người có chiều dài là một vùng nhiễm sắc thể gồm 25,000 cặp nucleotide (25 kilobase) kéo dài từ đầu trình tự không mã hóa protein đến đuôi trình tự mã hóa protein, nhưng RNA thông tin (mRNA) đối với gene này chỉ dài 2.1 kilobase. Bạn nghĩ gì về sự khác biệt quá lớn này ?

19. Đưa ra công thức liên hệ giữa kích thước RNA với kích thước gene, với số lượng intron và với kích thước trung bình của intron.

20. Nếu một codon trong mRNA là 5' - UUA - 3', vẽ anticodon RNA (đối mã) sẽ bám vào codon này (đánh dấu đầu 5' và 3' ).

21. xem xét đoạn DNA sau:

5' - GCTTCCCAA - 3'

3' - CGAAGGGTT - 3'

Đề xuất mạch phía trên là mạch được RNA polymerase sử dụng.

a. Đoạn DNA sẽ được phiên mã từ trái sang phải như hình vẽ hay từ phải sang trái ?

b. Vẽ đoạn DNA được mã hóa.

c. Đánh dấu đầu 5' và 3' của đoạn RNA đó.

28. So sánh và đối chiếu các quá trình sử dụng thông tin để hình thành một cơ thể sống và xây cất một tòa nhà.

32. Có phải công thức "kiểu gene + môi trường = kiểu hình" là chính xác ?



Liên kết đến đây